Panz's profileAnimated StardustPhotosBlogLists Tools Help

Animated Stardust

- We arose from the ashes of these shining giants in the universe, and one day we will return to them. Our lives are on borrowed time, one life is all we have, LIVE IT!

Panz P

Occupation
Location
Interests
I live on the third rock from the sun at coordinates 1'34N and 103'84E
Photo 1 of 21

Quote of the Day

Loading...
The Unfolding of Language: An Evolutionary Tour of Mankind's Greatest Invention
The Alchemist
God Created the Integers: The Mathematical Breakthroughs that Changed History
THE TIME TRAVELER'S WIFE
Pnin (Everyman's Library Classics & Contemporary Classics)
The World Is Flat: The Globalized World in the Twenty-first Century
The Curious Incident of the Dog in the Night-Time
Blink
The Tipping Point: How Little Things Can Make a Big Difference
Breaking Dawn (The Twilight Saga, Book 4)
The Complete Robot (Robot Series)
Six Degrees: The Science of a Connected Age
Prime Obsession: Bernhard Riemann and the Greatest Unsolved Problem in Mathematics
The Elegant Universe: Superstrings, Hidden Dimensions, and the Quest for the Ultimate Theory
Tuesdays with Morrie: An Old Man, a Young Man and Life's Greatest Lesson
Blood Fever
Eragon
Nightfall
SilverFin
2/4/2010

Farewell

This could be my last post (or the last post for a long long time), and I hope in the past 4 years that I have endeavoured to keep this blog alive, I have preserved the zeitgeist of me, and of the world which I lived in. The 6 years of Raffles has been a splendid unforgettable journey, and I treasure every moment of it. Having moved to opposite the school compound, it feels unbelievably nostalgic to see fresh sec 1s walking past that gate, year after year. Rafflesians (and non-Rafflesians alike) have taught me the strength of friendship, the joys of exploration, the pride of achievement. To have loved and learned, feared and faltered, felt and found, hopes turn into experiences into cherished memories. And as I now stand on the edge of the uncertain world beyond, I hope the past will imbibe me with strength to move on. Alta alatis patent.

Army beckons tomorrow,  I leave the confort of my home with a pensive heart and a brooding mind. I hope that it will not destroy the me built by Raffles, the me which my friends are familiar with, the me - narcissistic though it may sound - that I have known and liked. Farewell to the old me. Vive ut vitas

As everyone start to disperse (girls especially), I really wonder when will our paths cross again. One wonder if that is the price of success, to say farewell to your dearests. Amicus optima vitae possessio. I will be missing y'all deeply, and I truly hope that fate will bring us together. To those who setting sail so soon, my heartiest wishes that you may have the wind in your steps. Amigos para siempre.


1/26/2010

Where do we go from here?

It suddenly occurred to me that perhaps that next time that we would be seeing one another again would be the 5th of March for the collection of A level certs, but after that, with everyone flying everyone doing everything, with our footprints will traverse the globe and diffusing to every corner of Earth, will there be a time for us to come back again, as we were now? Physics tells us that such a state of low entropy is exceedingly hard to achieve, and damn, physics is always right. 2 years ago(3 years ago actually), during the graduation ceremony for the RI sec4s, the date set was 2017 at the Albert Hong Hall, I wonder how many will actually turn up? Will the AAH even be there at 2017? Will life play tricks on us again? You bet it will.

When you aim for the skies, remember, leave behind you more than just a hurried goodbye.
1/23/2010

Unser Leben steuern gerade auf einen Wasserfall zu (Our lives are heading straight for a waterfall)

The rapids a rushing faster and faster, like a cauldron on steroids. To twigs or rick is going to save us this time. Ans please, forget all that cinematography from Hollywood. Just hang on, hang on tight, and try to keep that worry (or tears) from clouding your vision. After all, don't waterfalls produce the most splendid rainbows? Aye mate, we're going down. Swoosh.

p.s. Perhaps the most ironic things you'll see on the Singapore roads is a (angry) red Ferrari stuck in a traffic jam. A true Maranello Italian would cringe at this. sigh.

1/17/2010

NS - Dulce et decorum est pro patria mori

As my NS enlistment date nears, I'm increasingly reminded of the phrase "Dulce et decorum est pro patria mori" or "it is sweet and right to die for your country" immortaliseed by Wilfred Owen is his eponymous poem. Indeed, patriotism is a religion of its own, drenched the pages of history with its blood with its powers boundless and unimaginable. Hmm perhaps we will go in and taste that sweetness.
1/16/2010

ACTGCTAGCTAGCTACGCAT

sianz, identifying DNA sequences is tough, rly tough, identifying DNA sequences that TURN OUT TO BE YOUR FINGER is just plain -.- But it was rly fun, albeit tiring Smile
1/10/2010

A hot knife through butter, not

Some food for thought: It seems a very common phrase "like a hot knife through butter" used through describe the ease of movement, but, in actual fact, the phrase "like a knife through hot butter" is more apt because when you have a hot knife, like in the case where the knife is passed over a fire, the blade (presumably steel) will be easily oxidised due to the high temperature, thus it will become blunt and does not slide through butter easily, on the other hand, when you have a cool knife edge going through hot butter, it is easier because your cutting edge is sharp and the butter is soft because it is hot.

On a separate note, baking chocolate cookies has been a - in the words of Borat - GREAT SUCCESS, it is amazing how flour + sugar + eggs + water = almost everything that humanity feeds on. In two mornings I made two batches of epic win. :D

On another separate note, I'm really feeling the pain of adult fares now, just added $30 last week and this week I'm already down to $17. sianz.
1/5/2010

Paintball, So-Ju and stars; PCR, DGGE, and whatnot bio acronyms

WHEEE astro farewell! Open-mouthedOpen-mouthedOpen-mouthed Had great fun playing PAINtball yay, it was a great exercise in maths which the J3s (omg I feel so old) don't get very often now. A great thank you to the J2s for planning and my fellow J3s for turning up! Open-mouthed Go RJ Astro! We may have moved on, but our romance with the stars will never end.Red heartAstro. p.s. Did Amyas drink the So-Ju in the end?
Watched Time Traveller's Wife at home, it was a decent show, though I still prefer the book. There is just that something between the lines that movies cannot express.
Started work last week at  Waterhub, doing bacterial population analysis, a bio lab is really fun, partly because I have not experienced much of one in the past. But one thing I have issue with is that all seems to be running on faith: one colourless liquid into another into yet another, everything that happens is invisible to the naked eye, so you kinda have to believe that something is indeed going on in the Eppendorf tubes. On a separate point, I totally love microscopy work, for it resembles to such a great degree a telescope that even I was amazed. The cell clusters, bacteria, under staining, loos like clusters of stars, and there is one particular stain that resembles EXACTLY the shade of red that is Hydrogen alpha (6563 angstroms), I have seen all too many slides of H-alpha to be very sure. And it is very interesting to listen to microbilogists talk about tofu, beancurd (yes there is a difference), soy milk and soya sauce, hahaha.
p.s. I realised that wearing lab gloves all day long is a rather disgusting experience, as my hands are soaked in MY OWN FREAKING METABOLITE by the end of the day. ewww.



12/31/2009

A formality

HAPPY NEW YEAR! May the worries of 2009 evaporate and the wishes of 2010 come true early!

p.s. I'm typing with two less fingers because there is a suspicious-looking orange stain on my left pinkie and middle finger, dunno what I touched in the bio lab today, doesn't seem to deteriorate after washing or hand sanitizer :S
12/29/2009

No school isn't as good as whatit sounds...

well, not as good as what it started to be at least, you will get bored of all the lan trips, movies, soccer blahblah, and something will hold you back, something that is called "Why am I wasting my time?" pffft. Do something constructive, get a job, whatever, carpe diem. Like the common app essay. sux.
12/21/2009

Think Linguistics

There are a few trees in a garden. On one of them, a pear tree, there are pears (quite logical). But after a strong wind blew, there were neither pears on the tree nor on the ground. How come?

Ich glaube, dass es eine gute Idee ist, dass ich auf Deutsch bloggen soll. Es ist zu lang, seit ich aktive auf Deutsch schreiben. Außerdem überlege ich TESTDAF am nachsten Jahr zu schreiben, und es gibt wenige Zeit für ich. Deshalb soll ich mein Deutsch sofort widerholen anzufangen. Ich möchte sehen, wie Alles ausgeht.
12/20/2009

A Klein bottle of Beer

"Stanford syndrome: one day you feel pretty good about your chances and the next you think why-the-heck-did-I-even-bother." (Blosson, 2009)  I guess some people, like me, are indeed suffering from that now. C'est la vie.

Es ist ganz beduerlich, dass das Leben solche grausame Spiele auf us spielen.
Hier stehen wir am Scheideweg des Lebens, und jede Entscheidung ist mit einem schweren Herz gemacht. Es scheint oft, dass das Glück unserer Zukunft in der Balance liegt, und das ist zu schwer eine Wette, dass wir an unsere Entscheidung bereit zu stellen sind. Es ist das unvermeidlich Konflikten zwischen unserer Träume und ihre Opportunitätskosten, und da liegt der Schmerz. Trotzdem müssen wir noch an diesem schrecklichen Roulette des Schicksals teilnehmen. Manchmal fragen wir uns, warum können diese Sache nie einfach sein? Schade, Schweigen ist die einzige Antwort.

p.s. holy shit, I just wrote all that auf deutch (Y)




12/18/2009

A papercut

Sometimes life gives you a papercut, it hurts for a while, but the pain soon diminishes, yet you always have that nagging voic at the back of your head, insidiously reminding you of that papercut. The more you think of it, the louder that voice; the more you lick your wound, the more painful it gets. Sometimes optimism is the best medication, ignorance is often bliss. To have seen heaven in a wild flower is perhaps reward enough when the wind takes that flower away. To have held the hand of infinity is perhaps reward enough when eternity ends.

p.s.The brighter fire gives off a colder light, even physics knows how to compensate.

Avatar

EPIC EPIC EPIC SHOW! This sets the stage for the a new decade of awesome movies. Didn't let me down at all, even if the 3D was a little dis-orienteering, but everything was worth it. I lost count of the silent irrepressible "wow"s during the entire movie haha

Plus point: EPIC CINEMATOGRAPHY 'nuff said.
Minus point: The plot was a little predictable.

4.5/5
12/16/2009

No clear skies ahead

Looks like Copenhagen is crewing up pretty bad, what started out as a unanimous declaration of decisiveness gave away to differentiated responsibilities. If we don't do anything now, serious shit is going to happen. A lot of shit. I hope we do not need a 2012 to jolt our sense of emergency. Speaking of 2012, it is the usualy bullshit science, I can't imagine it would be that hard to put some proper science into disaster movies. Seriously... neutrinos heating the Earth's core, that's really far-far-far-fetched.
Tomorrow is the opening day of Avatar, the most EPIC movie of the decade. EPIC EPIC EPIC, can't wait.
p.s. On a prouder note, I made dinner all by myself today Open-mouthed
12/13/2009

Fever

Couldn't go to the Geminids star party yesterday night due to a sudden fever. The funny thing is, I can clearly remember the last time I had fever was EXACTLY 1 YEAR AGO, because I missed last year's Geminids star party due to a fever. this is one crazy piece of luck ><.
 

Tagboard

Loading...
Creative Commons License
This work by Pan Zi Xiang is licensed under a Creative Commons Attribution 3.0 Unported License.
Based on a work at 12thman.spaces.live.com.